View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7381_low_19 (Length: 214)
Name: NF7381_low_19
Description: NF7381
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7381_low_19 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 17 - 198
Target Start/End: Complemental strand, 12202611 - 12202426
Alignment:
| Q |
17 |
atcaatgtggcaactaaatttatgatatgaaaatgaagtgttaagtgatagtatatgataatgatttgtatcgaatttggttgcttttctcatataaatt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12202611 |
atcaatgtggcaactaaatttatgatatgaaaatgaagtgttaagtgatagtatatgataatgatttgtatcgaatttggttgcttttctcatataaatt |
12202512 |
T |
|
| Q |
117 |
--agacttcaattcccttattttactctcctactctcctagtttggtgggtagttgataggactctcgatgc--gaatgtgggttt |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||| |||| |||||||||||| |
|
|
| T |
12202511 |
agagacttcaattcccttattttactctcctactctcctagtttggtggatagttgtaaggactctcaatgcgagaatgtgggttt |
12202426 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University