View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7382_high_8 (Length: 261)
Name: NF7382_high_8
Description: NF7382
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7382_high_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 18 - 248
Target Start/End: Original strand, 51552954 - 51553184
Alignment:
| Q |
18 |
attattttgctgtgtatacagtggtgctaggagaaggatttttgggtctagcaatgggattcagaaacacagctggtcctgaaggacatcaagcagtagc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51552954 |
attattttgctgtgtatacagtggtgctaggagaaggatttttgggtctagcaatgggattcagaaacacagctggtcctgaaggacatcaagcagtagc |
51553053 |
T |
 |
| Q |
118 |
agctagagtccaagcagatcgtgctgtgtttgccaactgccgttttgaaggcttccaagacacgctatacacagtagcacatagacaattcttccgtagc |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
51553054 |
agctagagtccaagcagatcgtgctgtgtttgccaactgccgttttgaaggcttccaagacacgctatacacagtggcacatagacaattcttccgtagc |
51553153 |
T |
 |
| Q |
218 |
tgcatcataacaggaacaatcgatttcatct |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
51553154 |
tgcatcataacaggaacaatcgatttcatct |
51553184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University