View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7382_low_11 (Length: 228)
Name: NF7382_low_11
Description: NF7382
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7382_low_11 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 125; Significance: 2e-64; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 80 - 212
Target Start/End: Complemental strand, 34852579 - 34852447
Alignment:
| Q |
80 |
gcacttcgttttcacactaaggatctcgactattactcttaacgtatgtttggaactgcgtccaaaagcttcaaacacacgtccatatctaggtgtttac |
179 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34852579 |
gcacttcgttttcacactaaggatctcgactatcactcttaatgtatgtttggaactgcgtccaaaagcttcaaacacacgtccatatctaggtgtttac |
34852480 |
T |
|
| Q |
180 |
catgatttctacaagttataaagtgtagtttct |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
34852479 |
catgatttctacaagttataaagtgtagtttct |
34852447 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 17 - 52
Target Start/End: Complemental strand, 34852643 - 34852608
Alignment:
| Q |
17 |
atcatgaagttgtaatatcttctttcatttgcatgc |
52 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
34852643 |
atcatgaagttgtaatatcttctttcatttgcatgc |
34852608 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University