View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7383_high_16 (Length: 222)
Name: NF7383_high_16
Description: NF7383
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7383_high_16 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 122; Significance: 9e-63; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 122; E-Value: 9e-63
Query Start/End: Original strand, 24 - 206
Target Start/End: Original strand, 13454422 - 13454605
Alignment:
| Q |
24 |
acatattccacaatacaacactcttaatgctacgtctttttcgcatatttccctgaaaatttaacgtactaaattagattgaattatgataaaaacttcc |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13454422 |
acatattccacaatacaacactcttaatgctacgtctttttcgcatatttccctgaaaatttaacgtactaaattagattgaattatgataaaaacttcc |
13454521 |
T |
|
| Q |
124 |
ttctctc-nnnnnnnnnnnnnnnnnnacaagatcaaacttccttcttagcattctattttatgatttttattattgttattgat |
206 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13454522 |
ttctctctctctttttttttttttttacaagatcaaacttccttcttagcattctattttatgatttttattattgttattgat |
13454605 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University