View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7383_high_19 (Length: 203)
Name: NF7383_high_19
Description: NF7383
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7383_high_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 101; Significance: 3e-50; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 87 - 187
Target Start/End: Original strand, 2510171 - 2510271
Alignment:
| Q |
87 |
caaatatgatttaagaggagagtgaagattttagtggattagcttaaacttaacgagtttcagttgggatgagtgtctaaaagagctttcttctttgaaa |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2510171 |
caaatatgatttaagaggagagtgaagattttagtggattagcttaaacttaacgagtttcagttgggatgagtgtctaaaagagctttcttctttgaaa |
2510270 |
T |
 |
| Q |
187 |
g |
187 |
Q |
| |
|
| |
|
|
| T |
2510271 |
g |
2510271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 153 - 187
Target Start/End: Original strand, 2511948 - 2511982
Alignment:
| Q |
153 |
ggatgagtgtctaaaagagctttcttctttgaaag |
187 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |
|
|
| T |
2511948 |
ggatgagtgtctaaaggagctttcttctttgaaag |
2511982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University