View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7383_high_4 (Length: 491)
Name: NF7383_high_4
Description: NF7383
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7383_high_4 |
 |  |
|
| [»] chr5 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 275; Significance: 1e-153; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 275; E-Value: 1e-153
Query Start/End: Original strand, 151 - 491
Target Start/End: Original strand, 10820039 - 10820383
Alignment:
| Q |
151 |
ggttctacccggctcgatagattaacctttatagttgcatacaaaagatacctgattcacaccaaaaaaggtcacactaagnnnnnnnattttaggtgtc |
250 |
Q |
| |
|
|||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
10820039 |
ggttctacccggttcgatagattaacctttgtagttgcatacaaaagatacctgattcacaccaaaaaaggtcacactaagtttttttattttaggtgtc |
10820138 |
T |
 |
| Q |
251 |
taaacatattgaacacgtactgcataagtgcatagtatgatag----tagcaagagcttcttgtttgcttgatccactttactgcataacattgattatt |
346 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| | ||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10820139 |
taaacatattgaacacgtactgcataagtgcatagtatgattgatggtagcaagagtttcttgtttgcttgatccactttactgcataacattgattatt |
10820238 |
T |
 |
| Q |
347 |
tggattccaaaattcctttgcctaccaaacttgaccaaagatttagttttcttgtatgttttgattcgaatctttggaagtgaattggtggaaataagca |
446 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
10820239 |
tggattccaaaattcctttgcctaccaaacttgaccaaagatttagttttcttgtatgttatgattcgaatctttggaagtgaattagtggaaataagca |
10820338 |
T |
 |
| Q |
447 |
ccagctttcgaccaaaagagggctgtcatgagatcagcttttaat |
491 |
Q |
| |
|
||||||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
10820339 |
ccagctttcgaacaaaagagtgctgtcatgagatcagcttttaat |
10820383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 16 - 66
Target Start/End: Original strand, 10819915 - 10819965
Alignment:
| Q |
16 |
attcacatggcaatgagaggaatcatgaggtcatagtggtgaggctatatg |
66 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10819915 |
attcacatggcaatgagaggaatcatgaggtcatagtggtgaggctatatg |
10819965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University