View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7383_low_19 (Length: 215)
Name: NF7383_low_19
Description: NF7383
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7383_low_19 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 20 - 200
Target Start/End: Original strand, 7308791 - 7308971
Alignment:
| Q |
20 |
agagatggtgagagagaatttgtggcggttggtgaaggagaggaactctttcgatacggtggagagaggttttaaataacggtcgcagtcggcgtcgtcg |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7308791 |
agagatggtgagagagaatttgtggcggttggtgaaggagaggaactctttcgatacggtggagagaggttttaaataacggtcgcagtcggcgtcgtcg |
7308890 |
T |
|
| Q |
120 |
ccgtcgaggaggagtttgaagatgcgtagccagcaatcatccggtaaataaaataaatctgcagcagaagcccttattttt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7308891 |
ccgtcgaggaggagtttgaagatgcgtagccagcaatcatccggtaaataaaataaatctgcagcagaagcccttattttt |
7308971 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 27 - 64
Target Start/End: Complemental strand, 34935811 - 34935774
Alignment:
| Q |
27 |
gtgagagagaatttgtggcggttggtgaaggagaggaa |
64 |
Q |
| |
|
||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
34935811 |
gtgagagagaatttgtgacggttggtgacggagaggaa |
34935774 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University