View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7383_low_9 (Length: 284)
Name: NF7383_low_9
Description: NF7383
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7383_low_9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 144; Significance: 9e-76; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 144; E-Value: 9e-76
Query Start/End: Original strand, 1 - 203
Target Start/End: Original strand, 43331538 - 43331743
Alignment:
| Q |
1 |
acgatttaggttcagacaaatttctctccaccgatgaaagattggacaagcacaaatacatgttatttatgatgagtgagatttttattagagcacatta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||| |||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
43331538 |
acgatttaggttcagacaaatttctctccaccgatgatagattggacaagcgcaaatacatgctatttatgatgagtgatatttttattagagcgcatta |
43331637 |
T |
 |
| Q |
101 |
gtatataatcattgtgtacacactcctattatactcgtaatgagtgtacttannnnnnnngggtacaattatgaatg---tactaattactgaatgtatc |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
43331638 |
ctatataatcattgtgtacacactcctattatactcgtaatgagtgtacttattttttttgggtacaattatgaatgtactactaattactgaatgtatc |
43331737 |
T |
 |
| Q |
198 |
ttataa |
203 |
Q |
| |
|
|||||| |
|
|
| T |
43331738 |
ttataa |
43331743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 216 - 261
Target Start/End: Original strand, 43332180 - 43332225
Alignment:
| Q |
216 |
gtaattttgatccaatacttttgctctgaccaaattaacaattatt |
261 |
Q |
| |
|
||||||||||||||||||||||||| | |||||||||||||||||| |
|
|
| T |
43332180 |
gtaattttgatccaatacttttgcttttaccaaattaacaattatt |
43332225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University