View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7384_low_10 (Length: 239)
Name: NF7384_low_10
Description: NF7384
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7384_low_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 1 - 233
Target Start/End: Original strand, 10078842 - 10079074
Alignment:
| Q |
1 |
tgccacaggcacaaccaaactcgtccccttttcattcaccaacaccgtcctcatctaacaacaacccacaaacttctcaccctggcttaacatctgcaaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
10078842 |
tgccacaggcacaaccaaactcgtccccttttcattcaccaacaccgtcctcatctaacaacaacccgcaaacttctcaccctggcttaacatctgcaaa |
10078941 |
T |
 |
| Q |
101 |
tcacatgggtacagtaaactcaccagctaatatttccatgcaacaacagcaggcatctgtttctggtgaagccgaccctagtaatgatgctcagaactcg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
10078942 |
tcacatgggtacagtaaactcaccagctaatatttccatgcaacaacagcaggcatctgtttctggtgaagctgaccctagtaatgatgctcagaactcg |
10079041 |
T |
 |
| Q |
201 |
gtccagaaaataattcacgacatgatgatgtcc |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
10079042 |
gtccagaaaataattcacgacatgatgatgtcc |
10079074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 73
Target Start/End: Complemental strand, 40776080 - 40776005
Alignment:
| Q |
1 |
tgccacaggcacaaccaaactcgtccccttttcattcacca---acaccgtcctcatctaacaacaacccacaaac |
73 |
Q |
| |
|
|||||||||| || |||||||| ||||||||||| |||||| ||||| ||||||||||| ||| ||||||||| |
|
|
| T |
40776080 |
tgccacaggcccagccaaactcatccccttttcagtcaccacctacaccatcctcatctaataaccccccacaaac |
40776005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University