View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7384_low_8 (Length: 250)
Name: NF7384_low_8
Description: NF7384
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7384_low_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 1 - 241
Target Start/End: Complemental strand, 10078771 - 10078531
Alignment:
| Q |
1 |
tgaattttgctgtctagcgttcatagagttctggtggagaagtccaacaatggtgcttgtggtggtcgatgcagatgctgaattgacattgttatttaca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10078771 |
tgaattttgctgtctagcgttcatagagttctggtggagaagtccaacaatggtgcttgtggtggtcgatgcagatgctgaattgacattgttatttaca |
10078672 |
T |
 |
| Q |
101 |
cttaccacaccattgttagaagggacttgcatagcagcagcttgcacagagttttgatcaccatttgagttgggggccaccatatgctgctgttgctgct |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
10078671 |
cttaccacaccattgttagaagggacttgcatagcagcagcttgcacagagttttgatcaccatttgagttgggggccaccatatgctgttgttgctgct |
10078572 |
T |
 |
| Q |
201 |
gtaattgttcttcagactgttgcgcctgattatgatgtcca |
241 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
10078571 |
gtaattgatcttcagactgttgcgcctgattatgatgtcca |
10078531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 11 - 171
Target Start/End: Original strand, 40776158 - 40776318
Alignment:
| Q |
11 |
tgtctagcgttcatagagttctggtggagaagtccaacaatggtgcttgtggtggtcgatgcagatgctgaattgacattgttatttacacttaccacac |
110 |
Q |
| |
|
||||||| |||| |||||| |||||||||||||||||||| ||||||||||| || ||||| || || || |||||| |||||||||| |||| || |
|
|
| T |
40776158 |
tgtctagaattcacagagttttggtggagaagtccaacaatagtgcttgtggttgttgatgcggacgccgagttgacagaactatttacactaaccatac |
40776257 |
T |
 |
| Q |
111 |
cattgttagaagggacttgcatagcagcagcttgcacagagttttgatcaccatttgagtt |
171 |
Q |
| |
|
||||| | |||| | |||||| | |||||||||||| | ||||||||| ||||||||||| |
|
|
| T |
40776258 |
cattgctggaagcaatttgcatggaagcagcttgcactgggttttgatcgccatttgagtt |
40776318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University