View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7385_low_7 (Length: 250)
Name: NF7385_low_7
Description: NF7385
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7385_low_7 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 241
Target Start/End: Complemental strand, 32052541 - 32052300
Alignment:
| Q |
1 |
aaatatttggttggaatttattcgttccattataattttgcaaatccatatgcaccttatcttaaccacaaatatttctgaagtacataacgtgtcacct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
32052541 |
aaatatttggttggaatttattcgttccattataattttgcaaatccatatgcaccttatcttaaccacaaatatttctaaagtacataacgtgtcacct |
32052442 |
T |
 |
| Q |
101 |
tattgacttgtaaactcaaattcaatgtacaccttacattatgtcaccccc-nnnnnnntcaacatagtaaaacgacaagacaacattacattatttcac |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32052441 |
tattgacttgtaaactcaaattcaatgtacaccttacattttgtcacccccaaaaaaaatcaacatagtaaaacgacaagacaacattacattatttcac |
32052342 |
T |
 |
| Q |
200 |
tcccaaagtatagaactaggtgccacatcttgccagtattat |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
32052341 |
tcccaaagtatagaactaggtgccacatcttgccattattat |
32052300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University