View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7386_low_18 (Length: 222)
Name: NF7386_low_18
Description: NF7386
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7386_low_18 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 82; Significance: 7e-39; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 123 - 204
Target Start/End: Complemental strand, 15821208 - 15821127
Alignment:
| Q |
123 |
acttggaattattaatggcaacgtgaattcaaatgggtaaataaagccaaactgagattaaatttctatggaaaataagggt |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15821208 |
acttggaattattaatggcaacgtgaattcaaatgggtaaataaagccaaactgagattaaatttctatggaaaataagggt |
15821127 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 52 - 124
Target Start/End: Complemental strand, 15821559 - 15821487
Alignment:
| Q |
52 |
acacgaacagtagcgcatcaaatttctttcaatggattgatgggattaagcagcagcaatgaacaagtaatac |
124 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15821559 |
acacgaacagtagcgtatcaaattgctttcaatggattgatgggattaagcagcagcaatgaacaagtaatac |
15821487 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University