View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7386_low_21 (Length: 217)
Name: NF7386_low_21
Description: NF7386
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7386_low_21 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 111; Significance: 3e-56; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 111; E-Value: 3e-56
Query Start/End: Original strand, 18 - 128
Target Start/End: Original strand, 42014493 - 42014603
Alignment:
| Q |
18 |
aggttttggcctcctaggattgaagctgctgagtttgatcggttgcctaggttgctttatgctgctgttaaagctaggaagaatcatatgaagaaggagg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42014493 |
aggttttggcctcctaggattgaagctgctgagtttgatcggttgcctaggttgctttatgctgctgttaaagctaggaagaatcatatgaagaaggagg |
42014592 |
T |
|
| Q |
118 |
tagtaaaagtt |
128 |
Q |
| |
|
||||||||||| |
|
|
| T |
42014593 |
tagtaaaagtt |
42014603 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 108; Significance: 2e-54; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 21 - 128
Target Start/End: Original strand, 1247724 - 1247831
Alignment:
| Q |
21 |
ttttggcctcctaggattgaagctgctgagtttgatcggttgcctaggttgctttatgctgctgttaaagctaggaagaatcatatgaagaaggaggtag |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1247724 |
ttttggcctcctaggattgaagctgctgagtttgatcggttgcctaggttgctttatgctgctgttaaagctaggaagaatcatatgaagaaggaggtag |
1247823 |
T |
|
| Q |
121 |
taaaagtt |
128 |
Q |
| |
|
|||||||| |
|
|
| T |
1247824 |
taaaagtt |
1247831 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University