View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7386_low_22 (Length: 201)
Name: NF7386_low_22
Description: NF7386
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7386_low_22 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 1 - 180
Target Start/End: Original strand, 50081866 - 50082044
Alignment:
| Q |
1 |
tgttcgtccagacatgtgatgtccttcaattccatcactgaatttctgatgaaagaattctcatttactacactcatgaatgcaccggcttttttatcgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
50081866 |
tgttcgtccagacatgtgatgtccttcaattccatcactgaatttctgatgaaagaattctcatttacgacactcatgaatgcaccggcttttttatcgg |
50081965 |
T |
 |
| Q |
101 |
tcaagggagagaggggttgaaaataaaaagtcacttgcgtaactaactgtacttttttctgatcgatataaatttggcat |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
50081966 |
tcaagggagagaggggttgaaaataaaaagtcacttgcgtaactaactgtac-tttttctgatcgatataaatttggcat |
50082044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University