View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7388_high_4 (Length: 256)
Name: NF7388_high_4
Description: NF7388
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7388_high_4 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 22 - 243
Target Start/End: Original strand, 525896 - 526117
Alignment:
| Q |
22 |
ttttcacctcttctcaggcttcaccatcaccacctcctaagtaataatcttctatcatattcaaactcattttgcatgtgttttttcattctcttttagg |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
525896 |
ttttcacctcttctcaggcttcaccatcaccacctcctaactaataatcttatatcatattcaaactcatttttcatgtgttttttcattctcttttagg |
525995 |
T |
 |
| Q |
122 |
acaacctcttaaaccatagcagttccataattcccttcccacacccccacccacttgttttttagtttcttatactacatgacccacttacatatatgtt |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
525996 |
acaacctcttaaaccatagcagttccataattcccttcccacacccccacccacttgttttttagtttcttatactacatgacccacttacatatatgtt |
526095 |
T |
 |
| Q |
222 |
ccaatcgcaacgtctctctgct |
243 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
526096 |
ccaatcgcaacgtctctctgct |
526117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University