View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7390_high_2 (Length: 239)
Name: NF7390_high_2
Description: NF7390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7390_high_2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 136; Significance: 4e-71; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 80 - 223
Target Start/End: Complemental strand, 24291969 - 24291826
Alignment:
| Q |
80 |
ataggtcgcaagcgcatagttctatcgtgcaattaaaatatcaaatccatgaggactatgtcgagtatcaattttgttttctctgatgattagctaaaaa |
179 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24291969 |
ataggtcgcaagcgcatagttctatcgtgcaattaaaatatcaaatccacgaggactatgtcgagtatcaattttgttttctctgatgattagctaaaaa |
24291870 |
T |
 |
| Q |
180 |
gaacagttgttcgagacatgattttggttggaaaattctgcaat |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
24291869 |
gaacagttgttcgagacatgattttggttgaaaaattctgcaat |
24291826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 1 - 79
Target Start/End: Complemental strand, 24292464 - 24292386
Alignment:
| Q |
1 |
tgagatttctcaatggcccatctttggagacaacaaacttgtgggaaggaagataagtaatatccctttatctattgat |
79 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24292464 |
tgagatttctcaatggcccatctttggagacaacagacttgtgggaaggaagataagtaatatccctttatctattgat |
24292386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University