View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7390_low_3 (Length: 333)
Name: NF7390_low_3
Description: NF7390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7390_low_3 |
 | |
|
| [»] scaffold1221 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold1221 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: scaffold1221
Description:
Target: scaffold1221; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 14 - 315
Target Start/End: Complemental strand, 1294 - 995
Alignment:
| Q |
14 |
atatactgctcttattttcaacctcatttttgtataaatcacaaatttccattttctttcttgatatccaattcccttttagaattcaaacctgaaattt |
113 |
Q |
| |
|
||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1294 |
atatactgctcttattttcaaactc-tttttgtataaatcacaaatttccattttctatcttgatatccaattcccttttagaattcaaacctgaaattt |
1196 |
T |
|
| Q |
114 |
tattttttggtgataaattggattttgtttcaaaatttcatccaactttctactatgatgcaggcaagtatgcatgtgttatgactgttttctttttaac |
213 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1195 |
cattttt-ggtgataaattggattttgtttcaaaatttcatacaactttctactatgatgcaagcaagtatgcatgtgttatgactgttttctttttaac |
1097 |
T |
|
| Q |
214 |
agggtcttctgataaacatttcaggtgtagggaagagttggttacctttagaattttctaccagttgtctactacctaaaaatttgtcaggtactttaag |
313 |
Q |
| |
|
|||||||||||||||||||||||||||| || |||||||||||||||||||||||||||| || || ||||||||||||||||||||||||||||||||| |
|
|
| T |
1096 |
agggtcttctgataaacatttcaggtgtgggtaagagttggttacctttagaattttctagcaattttctactacctaaaaatttgtcaggtactttaag |
997 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 95; Significance: 2e-46; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 21 - 178
Target Start/End: Complemental strand, 14566716 - 14566555
Alignment:
| Q |
21 |
gctcttattttcaacctcatttttgtataaatcacaaatttccattttctttcttgatatccaattcccttttagaattcaaacctgaaattttattttt |
120 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||| |||||| |||||||| | |||| |
|
|
| T |
14566716 |
gctcttattttcaaactcatttttgtataaatcacaaatttccattttctatcttgatatccaattccctcttagacttcaaatttgaaatttca-tttt |
14566618 |
T |
|
| Q |
121 |
tggtgataaattgga-----ttttgtttcaaaatttcatccaactttctactatgatgcaggc |
178 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
14566617 |
tggtgataaattggattgctttttgtttcaaaatttcatttaactttctattatgatgcaggc |
14566555 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University