View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7390_low_8 (Length: 239)

Name: NF7390_low_8
Description: NF7390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7390_low_8
NF7390_low_8
[»] chr4 (2 HSPs)
chr4 (80-223)||(24291826-24291969)
chr4 (1-79)||(24292386-24292464)


Alignment Details
Target: chr4 (Bit Score: 136; Significance: 4e-71; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 80 - 223
Target Start/End: Complemental strand, 24291969 - 24291826
Alignment:
80 ataggtcgcaagcgcatagttctatcgtgcaattaaaatatcaaatccatgaggactatgtcgagtatcaattttgttttctctgatgattagctaaaaa 179  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||    
24291969 ataggtcgcaagcgcatagttctatcgtgcaattaaaatatcaaatccacgaggactatgtcgagtatcaattttgttttctctgatgattagctaaaaa 24291870  T
180 gaacagttgttcgagacatgattttggttggaaaattctgcaat 223  Q
    |||||||||||||||||||||||||||||| |||||||||||||    
24291869 gaacagttgttcgagacatgattttggttgaaaaattctgcaat 24291826  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 1 - 79
Target Start/End: Complemental strand, 24292464 - 24292386
Alignment:
1 tgagatttctcaatggcccatctttggagacaacaaacttgtgggaaggaagataagtaatatccctttatctattgat 79  Q
    ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
24292464 tgagatttctcaatggcccatctttggagacaacagacttgtgggaaggaagataagtaatatccctttatctattgat 24292386  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University