View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7392_high_9 (Length: 234)
Name: NF7392_high_9
Description: NF7392
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7392_high_9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 158 - 217
Target Start/End: Original strand, 41749568 - 41749627
Alignment:
| Q |
158 |
atatttctcatgtccctcttcnnnnnnngtgaccaaaagggaaaatcaacaacgttatct |
217 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
41749568 |
atatttctcatgtccctcttctttttttgtgaccaaaagggaaaatcaacaacgttatct |
41749627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University