View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7392_high_9 (Length: 234)

Name: NF7392_high_9
Description: NF7392
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7392_high_9
NF7392_high_9
[»] chr8 (1 HSPs)
chr8 (158-217)||(41749568-41749627)


Alignment Details
Target: chr8 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 158 - 217
Target Start/End: Original strand, 41749568 - 41749627
Alignment:
158 atatttctcatgtccctcttcnnnnnnngtgaccaaaagggaaaatcaacaacgttatct 217  Q
    |||||||||||||||||||||       ||||||||||||||||||||||||||||||||    
41749568 atatttctcatgtccctcttctttttttgtgaccaaaagggaaaatcaacaacgttatct 41749627  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University