View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7393_high_5 (Length: 238)
Name: NF7393_high_5
Description: NF7393
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7393_high_5 |
 |  |
|
| [»] chr2 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 145; Significance: 2e-76; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 74 - 238
Target Start/End: Complemental strand, 2803643 - 2803479
Alignment:
| Q |
74 |
ttaatgtttatgttaatgttaaagaggttcaataggacaagctggttttcgagatgctacttgattgtactttgtgatggattcaacatcatgcctcaat |
173 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2803643 |
ttaatgttaatgttaatgttaaagaggttcaataggacaagctggttttcgagatgctacttgattgtactttgtgatggattcaacatcatgcctcaat |
2803544 |
T |
 |
| Q |
174 |
gtttagcagcggttttctcggtaaagaggatgactacctaccacaaatgtccctgccatgctctg |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| |||||||| |||| ||||||||||||| |
|
|
| T |
2803543 |
gtttagcagcggttttctcggtaaagaggatgaatacataccacaactgtcactgccatgctctg |
2803479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 15 - 55
Target Start/End: Complemental strand, 2803764 - 2803724
Alignment:
| Q |
15 |
acatcaaaaagccagagccatgaattcctaatgcatagtta |
55 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2803764 |
acatcaaaaagccagagccatgaattcctaatgcatagtta |
2803724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 56 - 95
Target Start/End: Complemental strand, 2803673 - 2803634
Alignment:
| Q |
56 |
gttaatttgatcaaaatattaatgtttatgttaatgttaa |
95 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
2803673 |
gttaattttatcaaaatattaatgtttatgttaatgttaa |
2803634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University