View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7396_high_17 (Length: 246)
Name: NF7396_high_17
Description: NF7396
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7396_high_17 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 1 - 230
Target Start/End: Original strand, 25796247 - 25796476
Alignment:
| Q |
1 |
caataggttgataactctagtttatctgctacaggtattatcaaccctgacactagcagcagctgcctcaacagctagtgttgtagatctcctgctaaat |
100 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25796247 |
caataggttgataactctagtttatttgctacaggtattatcaaccctgacactagcagcagctgcctcaacagctagtgttgtagatctcctgctaaat |
25796346 |
T |
|
| Q |
101 |
tctcaaggatctttttgccctataaagctttgctgcaggtacaggatatctgcagttatggcttttgtgtcatggtttctgtccttggcatcatctcttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25796347 |
tctcaaggatctttttgccctataaagctttgctgcaggtacaggatatctgcagttatggcttttgtgtcatggtttctgtccttggcatcatctcttt |
25796446 |
T |
|
| Q |
201 |
ttaacctttacctgctaccttctttgtgat |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
25796447 |
ttaacctttacctgctaccttctttgtgat |
25796476 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University