View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7396_high_18 (Length: 236)

Name: NF7396_high_18
Description: NF7396
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7396_high_18
NF7396_high_18
[»] chr3 (1 HSPs)
chr3 (1-219)||(7988954-7989172)


Alignment Details
Target: chr3 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 219
Target Start/End: Complemental strand, 7989172 - 7988954
Alignment:
1 ttcttcataaaggtgggatctttgttcggagattttcttgactatgatgaggagactgcatcaatggaaaggcttgatagggcaagaattcaaatttcca 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7989172 ttcttcataaaggtgggatctttgttcggagattttcttgactatgatgaggagactgcatcaatggaaaggcttgatagggcaagaattcaaatttcca 7989073  T
101 ctcataggtgggaaggattggtgtgatgggtgctaattttaaggtgtgggttgtggaggagcaggatgaaggtgaagttttgatgcaggaggaggatggt 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||    
7989072 ctcataggtgggaaggattggtgtgatgggtgctaattttaaggtgtgggttgtagaggagcaggatgaaggtgaagttttgatgcaggagaaggatggt 7988973  T
201 tgtttggtggagggctcgt 219  Q
    |||||||||||||||||||    
7988972 tgtttggtggagggctcgt 7988954  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University