View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7396_low_21 (Length: 221)
Name: NF7396_low_21
Description: NF7396
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7396_low_21 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 45 - 175
Target Start/End: Complemental strand, 15866506 - 15866376
Alignment:
| Q |
45 |
acacgcacacacttcttagtcccttgtttactcagactgatcatactcaatccactgttgttctatttttctagacttggtttttaactatgagtgtctt |
144 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15866506 |
acacgcacacacttcttagtcccttgtttactcagactgatcatactcaatccactgttgttctatttttctagacttggtttttaactatgagtgtctt |
15866407 |
T |
 |
| Q |
145 |
taatttaatgaaagttttatatttcagagca |
175 |
Q |
| |
|
|||||||||||||||||||||||||| |||| |
|
|
| T |
15866406 |
taatttaatgaaagttttatatttcaaagca |
15866376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 103 - 175
Target Start/End: Original strand, 22798563 - 22798635
Alignment:
| Q |
103 |
tgttctatttttctagacttggtttttaactatgagtgtctttaatttaatgaaagttttatatttcagagca |
175 |
Q |
| |
|
|||||| |||||||||||| |||||||||||||||||||||||||||| |||| ||||||||| |||||| |
|
|
| T |
22798563 |
tgttctgtttttctagactaggtttttaactatgagtgtctttaattttgggaaacatttatatttgagagca |
22798635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University