View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7396_low_21 (Length: 221)

Name: NF7396_low_21
Description: NF7396
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7396_low_21
NF7396_low_21
[»] chr6 (1 HSPs)
chr6 (45-175)||(15866376-15866506)
[»] chr7 (1 HSPs)
chr7 (103-175)||(22798563-22798635)


Alignment Details
Target: chr6 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 45 - 175
Target Start/End: Complemental strand, 15866506 - 15866376
Alignment:
45 acacgcacacacttcttagtcccttgtttactcagactgatcatactcaatccactgttgttctatttttctagacttggtttttaactatgagtgtctt 144  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
15866506 acacgcacacacttcttagtcccttgtttactcagactgatcatactcaatccactgttgttctatttttctagacttggtttttaactatgagtgtctt 15866407  T
145 taatttaatgaaagttttatatttcagagca 175  Q
    |||||||||||||||||||||||||| ||||    
15866406 taatttaatgaaagttttatatttcaaagca 15866376  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 103 - 175
Target Start/End: Original strand, 22798563 - 22798635
Alignment:
103 tgttctatttttctagacttggtttttaactatgagtgtctttaatttaatgaaagttttatatttcagagca 175  Q
    |||||| |||||||||||| ||||||||||||||||||||||||||||   ||||  ||||||||| ||||||    
22798563 tgttctgtttttctagactaggtttttaactatgagtgtctttaattttgggaaacatttatatttgagagca 22798635  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University