View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7397_low_5 (Length: 329)
Name: NF7397_low_5
Description: NF7397
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7397_low_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 280; Significance: 1e-157; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 280; E-Value: 1e-157
Query Start/End: Original strand, 18 - 317
Target Start/End: Complemental strand, 25742020 - 25741721
Alignment:
| Q |
18 |
catatccggtggccggagcttcttctgcggcctccggtctaatggactcagcctacactgttggaacacaaggacacggaagtcttttctcaaacctaaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25742020 |
catatccggtggccggagcttcttctgcggcctccggtctaatggactcagcctacactgttggaacacaaggacacggaagtcttttctcaaacctaaa |
25741921 |
T |
 |
| Q |
118 |
agggtgtatcatagtgaaaatgttgagttgagtgatgtatctgttggtgatgatcatgtttgtgcaagagagttgcactctggtgtggtaaggtgctgga |
217 |
Q |
| |
|
|||||||||||||||||||||||| |||||| ||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||| |
|
|
| T |
25741920 |
agggtgtatcatagtgaaaatgttcagttgaatgatgtagctgttggtgatgatcatgtttgtgctagagagttgcactctggtgtggtaaggtgttgga |
25741821 |
T |
 |
| Q |
218 |
gaggttatggtgaaactaatggattcaagtttccttctcctgatgaaaattttcggtttcgaagcattacttgtggtactggtttttgttgtgggatatt |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25741820 |
gaggttatggtgaaactaatggattcaagtttccttctcctgatgaaaattttcggtttcgaagcattacttgtggtactggtttttgttgtgggatatt |
25741721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University