View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7398_low_13 (Length: 311)
Name: NF7398_low_13
Description: NF7398
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7398_low_13 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 9 - 295
Target Start/End: Original strand, 4224724 - 4225010
Alignment:
| Q |
9 |
agcagagacctaaatgtaacataacgctcaatttgtctaacacagtcgatttaaatatgtaccaagaggggtgtcaaattatgttggtcgattgattatg |
108 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
4224724 |
agcacagacctaaatgtaacataacgctcaatttgtctaacacagtcgatttaaatatgtaccaagaggaatgtcaaattatgttggtcgattgattatg |
4224823 |
T |
|
| Q |
109 |
ccactgcaccactagaacacatgtcaagttggtttttaaagattttatggacccttcgactttgctcaagtctcttttgatttataattatcagactgta |
208 |
Q |
| |
|
||||||||||| | ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4224824 |
ccactgcaccattggaacacatgtcaagttggtttttgaagattttatggacccttcgactttgctcaagtctcttttgatttataattatcagactgta |
4224923 |
T |
|
| Q |
209 |
actttcgattgcataaaacctatcagaaaatacaatccgatcgannnnnnnnnnnatcgaatgatatctcccgatagggtttatttc |
295 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||| |||||||||| |
|
|
| T |
4224924 |
actttcgattgcataaaacctatcagaaaatacaatccgatcgatttttttttctatcgaattatatctcccgataaggtttatttc |
4225010 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University