View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7398_low_19 (Length: 249)
Name: NF7398_low_19
Description: NF7398
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7398_low_19 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 20 - 232
Target Start/End: Complemental strand, 194594 - 194382
Alignment:
| Q |
20 |
atacagaaagatttatgcaagttttggaactgtcccaggatcgcccttctaagaaatggatagggagtggtgggatacaagaagctagggacttgatcat |
119 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
194594 |
atacagaaaggtttatgcaagttttggaactgtcccaagatcgcccttctaagaaatggatagggagtggtgggatacaagaagctagggacttgatcat |
194495 |
T |
 |
| Q |
120 |
aattcaacagaggcatacatggcagctgaacatgaatatggggatgggattgagaagggaaagaaactaatttatgatagtaatgatagtaagaagagaa |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
194494 |
aattcaacagaggcatacatggcagctgaacatgaatatggggatgggattgagaagggaaagaaactaatttatgatagtaatgatagtaagtagagaa |
194395 |
T |
 |
| Q |
220 |
ggaagcacatgat |
232 |
Q |
| |
|
||||||||||||| |
|
|
| T |
194394 |
ggaagcacatgat |
194382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University