View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7398_low_20 (Length: 248)
Name: NF7398_low_20
Description: NF7398
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7398_low_20 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 156; Significance: 5e-83; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 1 - 156
Target Start/End: Complemental strand, 32482311 - 32482156
Alignment:
| Q |
1 |
taataagaaaaagaaggacagaaaacagaaacagacggctaaacagtgtcgtggcagcaagcagcgttaatcacgctttcaatatcacttcccagctagc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32482311 |
taataagaaaaagaaggacagaaaacagaaacagacggctaaacagtgtcgtggcagcaagcagcgttaatcacgctttcaatatcacttcccagctagc |
32482212 |
T |
 |
| Q |
101 |
agctatagcttccttcaacgtttgtttttgtgtaatactcctaacttatgtttttt |
156 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32482211 |
agctatagcttccttcaacgtttgtttttgtgtaatactcctaacttatgtttttt |
32482156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 200 - 240
Target Start/End: Complemental strand, 32482111 - 32482071
Alignment:
| Q |
200 |
aggaaggaacagtaccacagtctttttacagctatctctgc |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32482111 |
aggaaggaacagtaccacagtctttttacagctatctctgc |
32482071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University