View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7398_low_22 (Length: 239)
Name: NF7398_low_22
Description: NF7398
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7398_low_22 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 18 - 224
Target Start/End: Original strand, 33769995 - 33770201
Alignment:
| Q |
18 |
gtaagtttggccaaatcatgctggtaaaatgattttgtgtagcttttnnnnnnnttgcggtgactcaccgtgatccagtcaatctcttcggactctctga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33769995 |
gtaagtttggccaaatcatgctggtaaaatgaatttgtgtagcttttaaaaaaattgcggtgactcaccgtgatccagtcaatctcttcggactctctga |
33770094 |
T |
 |
| Q |
118 |
acacgcattacctataagcatgtgtgccattttctacatgtcgagacattcttgccgtcaaaacatagaagctacaaaactaaacttctactaaaacgtt |
217 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33770095 |
acacgcattacctttaagcatgtgtgccattttctacatgtcgagacattcttgccgtcaaaacatagaagctacaaaactaaacttctactaaaacgtt |
33770194 |
T |
 |
| Q |
218 |
gtttctt |
224 |
Q |
| |
|
||||||| |
|
|
| T |
33770195 |
gtttctt |
33770201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University