View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7398_low_23 (Length: 217)

Name: NF7398_low_23
Description: NF7398
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7398_low_23
NF7398_low_23
[»] chr4 (2 HSPs)
chr4 (63-206)||(9731608-9731751)
chr4 (18-52)||(9731771-9731805)


Alignment Details
Target: chr4 (Bit Score: 144; Significance: 7e-76; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 63 - 206
Target Start/End: Complemental strand, 9731751 - 9731608
Alignment:
63 acagaagttatatataaatacttaaaactaatgaatagtgaaatacatgctaattattttacttgtttatacacacacaaaaaatatgggttgatagaga 162  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9731751 acagaagttatatataaatacttaaaactaatgaatagtgaaatacatgctaattattttacttgtttatacacacacaaaaaatatgggttgatagaga 9731652  T
163 aaatatatgaaatcatcactaattttgtcactaaatttaatatt 206  Q
    ||||||||||||||||||||||||||||||||||||||||||||    
9731651 aaatatatgaaatcatcactaattttgtcactaaatttaatatt 9731608  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 18 - 52
Target Start/End: Complemental strand, 9731805 - 9731771
Alignment:
18 ataaaccccattgatcatgaaaaaattatatacaa 52  Q
    |||||||||||||||||||||||||||||||||||    
9731805 ataaaccccattgatcatgaaaaaattatatacaa 9731771  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University