View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7398_low_23 (Length: 217)
Name: NF7398_low_23
Description: NF7398
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7398_low_23 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 144; Significance: 7e-76; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 63 - 206
Target Start/End: Complemental strand, 9731751 - 9731608
Alignment:
| Q |
63 |
acagaagttatatataaatacttaaaactaatgaatagtgaaatacatgctaattattttacttgtttatacacacacaaaaaatatgggttgatagaga |
162 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9731751 |
acagaagttatatataaatacttaaaactaatgaatagtgaaatacatgctaattattttacttgtttatacacacacaaaaaatatgggttgatagaga |
9731652 |
T |
|
| Q |
163 |
aaatatatgaaatcatcactaattttgtcactaaatttaatatt |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9731651 |
aaatatatgaaatcatcactaattttgtcactaaatttaatatt |
9731608 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 18 - 52
Target Start/End: Complemental strand, 9731805 - 9731771
Alignment:
| Q |
18 |
ataaaccccattgatcatgaaaaaattatatacaa |
52 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
9731805 |
ataaaccccattgatcatgaaaaaattatatacaa |
9731771 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University