View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7398_low_6 (Length: 486)
Name: NF7398_low_6
Description: NF7398
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7398_low_6 |
 | |
|
| [»] scaffold0200 (1 HSPs) |
| | |
|
Alignment Details
Target: chr3 (Bit Score: 105; Significance: 3e-52; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 105; E-Value: 3e-52
Query Start/End: Original strand, 10 - 126
Target Start/End: Complemental strand, 671826 - 671710
Alignment:
| Q |
10 |
aagaatatggaagatactcacaaaccaatccgcgagggctgtgatcaaagcctaacatcaccaccaccctcactttcatctgatgattcactttgcaccc |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||| |
|
|
| T |
671826 |
aagaatatggaagatactcacaaaccaatcagcgagggctgtgatcaaagcctaacatcaccaccaccctcactttcatctgattattccctttgcaccc |
671727 |
T |
|
| Q |
110 |
agccattacccactctt |
126 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
671726 |
agccattacccactctt |
671710 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 154 - 191
Target Start/End: Original strand, 13478852 - 13478889
Alignment:
| Q |
154 |
tgtagactactcgtgaagctcctccttcaacttcgatg |
191 |
Q |
| |
|
||||| |||| ||||||||||||||||||||||||||| |
|
|
| T |
13478852 |
tgtaggctacccgtgaagctcctccttcaacttcgatg |
13478889 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 328 - 384
Target Start/End: Complemental strand, 2696924 - 2696868
Alignment:
| Q |
328 |
gaaagtccatgcttttttgtttctcttgatttagaaaatgagacttatcaagaggtt |
384 |
Q |
| |
|
||||||||||| ||| |||||||||||||||| | ||||| | |||| ||||||||| |
|
|
| T |
2696924 |
gaaagtccatgttttattgtttctcttgatttgggaaatgtgtcttaccaagaggtt |
2696868 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 123 - 171
Target Start/End: Complemental strand, 43687154 - 43687106
Alignment:
| Q |
123 |
tcttccgctggacgttgtcgaagaaatcttgtgtagactactcgtgaag |
171 |
Q |
| |
|
||||||| | ||| |||| ||||||||||||||||||||||| |||||| |
|
|
| T |
43687154 |
tcttccgttcgaccttgtggaagaaatcttgtgtagactactggtgaag |
43687106 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0200 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: scaffold0200
Description:
Target: scaffold0200; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 331 - 409
Target Start/End: Complemental strand, 971 - 893
Alignment:
| Q |
331 |
agtccatgcttttttgtttctcttgatttagaaaatgagacttatcaagaggttccgaagccggattatggagaggtag |
409 |
Q |
| |
|
|||||||| ||| ||||||||||| |||||| |||||| |||||||||||||| | |||| ||||| ||||||||| |
|
|
| T |
971 |
agtccatgttttattgtttctcttaatttagggaatgagtcttatcaagaggttttgcagcctaattatagagaggtag |
893 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 331 - 409
Target Start/End: Complemental strand, 41973663 - 41973585
Alignment:
| Q |
331 |
agtccatgcttttttgtttctcttgatttagaaaatgagacttatcaagaggttccgaagccggattatggagaggtag |
409 |
Q |
| |
|
|||||||| ||| ||||||||||| |||||| |||||| |||||||||||||| | |||| ||||| ||||||||| |
|
|
| T |
41973663 |
agtccatgttttattgtttctcttaatttagggaatgagtcttatcaagaggttttgcagcctaattatagagaggtag |
41973585 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University