View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7398_low_7 (Length: 448)
Name: NF7398_low_7
Description: NF7398
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7398_low_7 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 107; Significance: 2e-53; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 107; E-Value: 2e-53
Query Start/End: Original strand, 304 - 426
Target Start/End: Original strand, 43336081 - 43336203
Alignment:
| Q |
304 |
agaagtatagatagcaaataaagaagaaaagtattaggagtgttcatcactccacacttgcataaacaacataaaaagctgtctgtgtcttaaatcttaa |
403 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| | |||||||||||||||| |||||||||||||||||| |
|
|
| T |
43336081 |
agaagtatagatagcaaataaagaagaaaagtattaggagtgttcatcacttcacacttgcacagacaacataaaaagctggctgtgtcttaaatcttaa |
43336180 |
T |
|
| Q |
404 |
ttgttgaacttgacatggacttg |
426 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
43336181 |
ttgttgaacttgacatggacttg |
43336203 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 1 - 65
Target Start/End: Original strand, 43340679 - 43340743
Alignment:
| Q |
1 |
ataggacagaacaaaaacaatagtaggaaagtggttgtgtaatcatacctgatcatgttcatgtt |
65 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||||||||| |||||||||| |||||||||||| |
|
|
| T |
43340679 |
ataggacagaacaaaaacaagagtagtaaagtggttgtgtattcatacctgagcatgttcatgtt |
43340743 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University