View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7399_low_11 (Length: 219)
Name: NF7399_low_11
Description: NF7399
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7399_low_11 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 46; Significance: 2e-17; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 107 - 171
Target Start/End: Original strand, 44682327 - 44682392
Alignment:
| Q |
107 |
taagtgacaaaggttgaa-gaaaactgaatgctgaatgagagagacaatttttttgaaagagtaaa |
171 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||| ||||||||||||| |||||||| |
|
|
| T |
44682327 |
taagtgacaaaggttgaaagaaaactgaatgctgaatgagagtcacaatttttttgagagagtaaa |
44682392 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 9 - 46
Target Start/End: Original strand, 44682239 - 44682276
Alignment:
| Q |
9 |
tggtggtggtaggatttgaggttgaagacggcggagga |
46 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44682239 |
tggtggtggtaggatttgaggttgaagacggcggagga |
44682276 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University