View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7400_high_12 (Length: 306)
Name: NF7400_high_12
Description: NF7400
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7400_high_12 |
 | |
|
| [»] scaffold0224 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0224 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: scaffold0224
Description:
Target: scaffold0224; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 1 - 285
Target Start/End: Original strand, 12997 - 13281
Alignment:
| Q |
1 |
ggaataggactcagtggattcacagtggcaacttgttctgaagttctatgggctttgatgtgagtttagggaaacaagttgaggcagaagcgattgaaat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
12997 |
ggaataggactcagtggattcacagtggcaagttgttctgaagttctatgggctttgatgtgagtttagggaaacaagttcaggctgaagcgattgaaat |
13096 |
T |
|
| Q |
101 |
gagtttgttgggtctgcaccggttaatgtctatgtgaaatggaccttgccagcaaggtgttcttttgcatgcagaatgaagcactgtagattgtgttgaa |
200 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
13097 |
gagtttgttgggtttgcaccggttaatgtctatgtgaaatggaccttgccagcaaggtgttcttttgcatgcagaatgaagcactgtggattgtgttgaa |
13196 |
T |
|
| Q |
201 |
agtttcgattgtttttccaaatattaaactttcgcgaatttacatttatgtctgcgtacatcacattacgtacaaaacttgcttg |
285 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13197 |
agtttcgattgtttttccaaatattaaactttagcgaatttacatttatgtctgcgtacatcacattacgtacaaaacttgcttg |
13281 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 1 - 285
Target Start/End: Complemental strand, 42933774 - 42933490
Alignment:
| Q |
1 |
ggaataggactcagtggattcacagtggcaacttgttctgaagttctatgggctttgatgtgagtttagggaaacaagttgaggcagaagcgattgaaat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
42933774 |
ggaataggactcagtggattcacagtggcaagttgttctgaagttctatgggctttgatgtgagtttagggaaacaagttcaggctgaagcgattgaaat |
42933675 |
T |
|
| Q |
101 |
gagtttgttgggtctgcaccggttaatgtctatgtgaaatggaccttgccagcaaggtgttcttttgcatgcagaatgaagcactgtagattgtgttgaa |
200 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
42933674 |
gagtttgttgggtttgcaccggttaatgtctatgtgaaatggaccttgccagcaaggtgttcttttgcatgcagaatgaagcactgtggattgtgttgaa |
42933575 |
T |
|
| Q |
201 |
agtttcgattgtttttccaaatattaaactttcgcgaatttacatttatgtctgcgtacatcacattacgtacaaaacttgcttg |
285 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42933574 |
agtttcgattgtttttccaaatattaaactttagcgaatttacatttatgtctgcgtacatcacattacgtacaaaacttgcttg |
42933490 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University