View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7400_low_12 (Length: 316)
Name: NF7400_low_12
Description: NF7400
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7400_low_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 258; Significance: 1e-143; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 258; E-Value: 1e-143
Query Start/End: Original strand, 1 - 308
Target Start/End: Complemental strand, 36353962 - 36353649
Alignment:
| Q |
1 |
tgttcctcttgtctatgatttcttatcagtcttcttttcatgaacgttggtttcctttcgctacaagatgaagatctaattctcaactagttggcatcta |
100 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
36353962 |
tgttcctcttgtttatgatttcttatcagtcttcttttcatgaacgttggtttcctttcgctacaagatgaagatctcattctcaactagttggtatcta |
36353863 |
T |
 |
| Q |
101 |
tatagaatcgacacttcagattggatgtctgataccgacatgatactgacatatatagttacgttcaaccactcgttttgttaaagaaatatta--gtgt |
198 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||| |||| |
|
|
| T |
36353862 |
tatagaatcgacacttcagattggaggtctgataccgacatgatactgatatatatagttacgttcaaccacttgttttgttaaagaaatattattgtgt |
36353763 |
T |
 |
| Q |
199 |
aggagctagtgcagtattgtgtctaatatttatgcttgtgtcgttgcttc----atcggttcacgttggaggtcagtgtgtgtgaactctatgtaatatt |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36353762 |
aggagctagtgcagtattgtgtctaatatttatgcttgtgtcgttgcttcatcgatcggttgacgttggaggtcagtgtgtgtgaactctatgtaatatt |
36353663 |
T |
 |
| Q |
295 |
tttcatagtataat |
308 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
36353662 |
tttcatagtataat |
36353649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 25 - 58
Target Start/End: Complemental strand, 36355224 - 36355191
Alignment:
| Q |
25 |
atcagtcttcttttcatgaacgttggtttccttt |
58 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
36355224 |
atcagtcttcttttcatgaacgttggtttccttt |
36355191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University