View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7400_low_17 (Length: 278)
Name: NF7400_low_17
Description: NF7400
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7400_low_17 |
 |  |
|
| [»] scaffold0632 (2 HSPs) |
 |  |  |
|
| [»] scaffold0156 (1 HSPs) |
 |  |  |
|
| [»] scaffold0315 (1 HSPs) |
 |  |  |
|
| [»] scaffold0027 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr2 (Bit Score: 42; Significance: 0.000000000000007; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 54 - 99
Target Start/End: Original strand, 20372075 - 20372120
Alignment:
| Q |
54 |
aaatggacccttgctgaaattttcagacttattgacttcattggac |
99 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
20372075 |
aaatggacccttgctgaaattttcggacttattgacttcattggac |
20372120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 228 - 260
Target Start/End: Complemental strand, 20621639 - 20621607
Alignment:
| Q |
228 |
gaggtacttcaaagtaacctctttgtcgaaatt |
260 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
20621639 |
gaggtacttcaaagtaacatctttgtcgaaatt |
20621607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 42; Significance: 0.000000000000007; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 54 - 99
Target Start/End: Complemental strand, 23950431 - 23950386
Alignment:
| Q |
54 |
aaatggacccttgctgaaattttcagacttattgacttcattggac |
99 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
23950431 |
aaatggacccttgctgaaattttcggacttattgacttcattggac |
23950386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 54 - 99
Target Start/End: Original strand, 28993302 - 28993347
Alignment:
| Q |
54 |
aaatggacccttgctgaaattttcagacttattgacttcattggac |
99 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
28993302 |
aaatggacccttgctgaaattttcggacttattgacttcattggac |
28993347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 58 - 95
Target Start/End: Original strand, 13806019 - 13806056
Alignment:
| Q |
58 |
ggacccttgctgaaattttcagacttattgacttcatt |
95 |
Q |
| |
|
|||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
13806019 |
ggacccttgctgaacttttcggacttattgacttcatt |
13806056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 228 - 260
Target Start/End: Original strand, 3432834 - 3432866
Alignment:
| Q |
228 |
gaggtacttcaaagtaacctctttgtcgaaatt |
260 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |
|
|
| T |
3432834 |
gaggtacttcaaagtaacctctttgtcaaaatt |
3432866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0632 (Bit Score: 38; Significance: 0.000000000002; HSPs: 2)
Name: scaffold0632
Description:
Target: scaffold0632; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 54 - 99
Target Start/End: Complemental strand, 4702 - 4657
Alignment:
| Q |
54 |
aaatggacccttgctgaaattttcagacttattgacttcattggac |
99 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
4702 |
aaatggacccttgctgaaattttttgacttattgacttcattggac |
4657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0632; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 228 - 260
Target Start/End: Complemental strand, 4511 - 4479
Alignment:
| Q |
228 |
gaggtacttcaaagtaacctctttgtcgaaatt |
260 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |
|
|
| T |
4511 |
gaggtacttcaaagtaacctctctgtcgaaatt |
4479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 38; Significance: 0.000000000002; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 54 - 99
Target Start/End: Original strand, 20532435 - 20532480
Alignment:
| Q |
54 |
aaatggacccttgctgaaattttcagacttattgacttcattggac |
99 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
20532435 |
aaatggacccttgctgaaattttcggacttattgacttcgttggac |
20532480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 228 - 260
Target Start/End: Original strand, 15391555 - 15391587
Alignment:
| Q |
228 |
gaggtacttcaaagtaacctctttgtcgaaatt |
260 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
15391555 |
gaggtacttcaaagtaacctctttgtcgaaatt |
15391587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 228 - 260
Target Start/End: Complemental strand, 13825824 - 13825792
Alignment:
| Q |
228 |
gaggtacttcaaagtaacctctttgtcgaaatt |
260 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |
|
|
| T |
13825824 |
gaggtacttcaaagtaacctctctgtcgaaatt |
13825792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0156 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0156
Description:
Target: scaffold0156; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 228 - 260
Target Start/End: Original strand, 35300 - 35332
Alignment:
| Q |
228 |
gaggtacttcaaagtaacctctttgtcgaaatt |
260 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
35300 |
gaggtacttcaaagtaacctctttgtcgaaatt |
35332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 33; Significance: 0.000000002; HSPs: 8)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 228 - 260
Target Start/End: Complemental strand, 31411011 - 31410979
Alignment:
| Q |
228 |
gaggtacttcaaagtaacctctttgtcgaaatt |
260 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
31411011 |
gaggtacttcaaagtaacctctttgtcgaaatt |
31410979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 228 - 260
Target Start/End: Original strand, 1728103 - 1728135
Alignment:
| Q |
228 |
gaggtacttcaaagtaacctctttgtcgaaatt |
260 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |
|
|
| T |
1728103 |
gaggtacttcaaagtaacctctttgtcaaaatt |
1728135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 228 - 260
Target Start/End: Complemental strand, 17638360 - 17638328
Alignment:
| Q |
228 |
gaggtacttcaaagtaacctctttgtcgaaatt |
260 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |
|
|
| T |
17638360 |
gaggtacttcaaagtaacctctctgtcgaaatt |
17638328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 228 - 260
Target Start/End: Original strand, 20372857 - 20372889
Alignment:
| Q |
228 |
gaggtacttcaaagtaacctctttgtcgaaatt |
260 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |
|
|
| T |
20372857 |
gaggtacttcaaagtaacctctctgtcgaaatt |
20372889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 228 - 260
Target Start/End: Original strand, 20398579 - 20398611
Alignment:
| Q |
228 |
gaggtacttcaaagtaacctctttgtcgaaatt |
260 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |
|
|
| T |
20398579 |
gaggtacttcaaagtaacctctctgtcgaaatt |
20398611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 228 - 260
Target Start/End: Original strand, 23350020 - 23350052
Alignment:
| Q |
228 |
gaggtacttcaaagtaacctctttgtcgaaatt |
260 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |
|
|
| T |
23350020 |
gaggtacttcaaagtaacctctttgccgaaatt |
23350052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 228 - 260
Target Start/End: Original strand, 29186222 - 29186254
Alignment:
| Q |
228 |
gaggtacttcaaagtaacctctttgtcgaaatt |
260 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| |
|
|
| T |
29186222 |
gaggcacttcaaagtaacctctttgtcgaaatt |
29186254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 228 - 260
Target Start/End: Complemental strand, 31421910 - 31421878
Alignment:
| Q |
228 |
gaggtacttcaaagtaacctctttgtcgaaatt |
260 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
31421910 |
gaggtacttcaaagtaacatctttgtcgaaatt |
31421878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0315 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold0315
Description:
Target: scaffold0315; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 228 - 260
Target Start/End: Original strand, 10600 - 10632
Alignment:
| Q |
228 |
gaggtacttcaaagtaacctctttgtcgaaatt |
260 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |
|
|
| T |
10600 |
gaggtacttcaaagtaacctctttgccgaaatt |
10632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0027 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold0027
Description:
Target: scaffold0027; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 228 - 260
Target Start/End: Original strand, 65648 - 65680
Alignment:
| Q |
228 |
gaggtacttcaaagtaacctctttgtcgaaatt |
260 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
65648 |
gaggtacttcaaagtaacatctttgtcgaaatt |
65680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000004; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 228 - 260
Target Start/End: Original strand, 4839726 - 4839758
Alignment:
| Q |
228 |
gaggtacttcaaagtaacctctttgtcgaaatt |
260 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
4839726 |
gaggtacttcaaagtaacttctttgtcgaaatt |
4839758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 228 - 260
Target Start/End: Original strand, 39837506 - 39837538
Alignment:
| Q |
228 |
gaggtacttcaaagtaacctctttgtcgaaatt |
260 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |
|
|
| T |
39837506 |
gaggtacttcaaagtaacctctttgtcaaaatt |
39837538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 228 - 260
Target Start/End: Original strand, 39845549 - 39845581
Alignment:
| Q |
228 |
gaggtacttcaaagtaacctctttgtcgaaatt |
260 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |
|
|
| T |
39845549 |
gaggtacttcaaagtaacctctttgtcaaaatt |
39845581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000004; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 228 - 260
Target Start/End: Complemental strand, 13831621 - 13831589
Alignment:
| Q |
228 |
gaggtacttcaaagtaacctctttgtcgaaatt |
260 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |
|
|
| T |
13831621 |
gaggtacttcaaagtaacctctttgtcaaaatt |
13831589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 228 - 260
Target Start/End: Complemental strand, 13839652 - 13839620
Alignment:
| Q |
228 |
gaggtacttcaaagtaacctctttgtcgaaatt |
260 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |
|
|
| T |
13839652 |
gaggtacttcaaagtaacctctttgtcaaaatt |
13839620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 228 - 260
Target Start/End: Original strand, 4523624 - 4523656
Alignment:
| Q |
228 |
gaggtacttcaaagtaacctctttgtcgaaatt |
260 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |
|
|
| T |
4523624 |
gaggtacttcaaagtaacctctttgtcaaaatt |
4523656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 228 - 260
Target Start/End: Original strand, 8154588 - 8154620
Alignment:
| Q |
228 |
gaggtacttcaaagtaacctctttgtcgaaatt |
260 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |
|
|
| T |
8154588 |
gaggtacttcaaagtaacctctttgtcaaaatt |
8154620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University