View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7400_low_18 (Length: 273)
Name: NF7400_low_18
Description: NF7400
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7400_low_18 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 235; Significance: 1e-130; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 17 - 263
Target Start/End: Complemental strand, 33238445 - 33238199
Alignment:
| Q |
17 |
catctatcccccattgaaaaatcaaatccattgcatcatcattcattttttcacctaaagggctcaacactgggacgataggcttatctgaataattcaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
33238445 |
catctatcccccattgaaaaatcaaatccattgcatcatcattcattttttcacctaaagggctcaacactgggacgataggcttatccgaataattcaa |
33238346 |
T |
|
| Q |
117 |
atgctctcttatgagtctaatgccaggtaactcagagaagtagtccactgcataaaatctgatcttattcttcaatgaatcgaacttgatcttctgatca |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
33238345 |
atgctctcttatgagtctaatgccaggtaactcagagaagtagtccactgcataaaatctgatcttattcttcaacgaatcgaacttgatcttctgatca |
33238246 |
T |
|
| Q |
217 |
tcaacatcccagatcgggatccacaaaatcttgaaatcctctttctt |
263 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33238245 |
tcgacatcccagatcgggatccacaaaatcttgaaatcctctttctt |
33238199 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 235 - 263
Target Start/End: Complemental strand, 33230560 - 33230532
Alignment:
| Q |
235 |
atccacaaaatcttgaaatcctctttctt |
263 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
33230560 |
atccacaaaatcttgaaatcctctttctt |
33230532 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University