View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7400_low_21 (Length: 261)
Name: NF7400_low_21
Description: NF7400
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7400_low_21 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 15 - 246
Target Start/End: Complemental strand, 37044563 - 37044333
Alignment:
| Q |
15 |
ggacatcaaggaccatactatggaggatcaaacaccttccacagaagatatgctatttacggtttttatcctaatgaaatacaacatggaaataaaggtc |
114 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37044563 |
ggacttcaaggaccatactatggaggatcaaacaccttccacagaagatatgctatttacggtttttatcctaatgaaatacaacatggaaataaaggtc |
37044464 |
T |
|
| Q |
115 |
ttgctctcacaagaaattcacttattcattgtatatctttattttatcagaatgtgatatggacacgattgataaaaaatatggtgtgtaatctgtgtaa |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||| ||||||||||||| |
|
|
| T |
37044463 |
ttgctctcacaagaaattcacttattcattgtatatctttattttatcagaatgtgatatgaacacgattgata-aaaatatggtgcgtaatctgtgtaa |
37044365 |
T |
|
| Q |
215 |
gttgtgaaagatgaaaaagtaagtgagagata |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
37044364 |
gttgtgaaagatgaaaaagtaagtgagagata |
37044333 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University