View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7400_low_24 (Length: 249)
Name: NF7400_low_24
Description: NF7400
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7400_low_24 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 1 - 242
Target Start/End: Original strand, 45763220 - 45763461
Alignment:
| Q |
1 |
gtttttgatcgccggtaacgctcatcagcttttggttttgccactgaaacgacgacgcatcattaaaaccgttaacgttaacattaccgttacggttatc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45763220 |
gtttttgatcgccggtaacgctcatcagcttttggttttgccactgaaacgacgacgcatcattaaaaccgttaacgttaacattaccgttacggttatc |
45763319 |
T |
 |
| Q |
101 |
gttaccgataccaaatccaaacggcaatgtctcgttagaggaagtgatcaagcttgtgaaagttgcgatctctgagaatataccacaatcacctgttcct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45763320 |
gttaccgataccaaatccaaacggcaatgtctcgttagaggaagtgatcaagcttgtgaaagttgcgatctctgagaatataccacaatcacctgttcct |
45763419 |
T |
 |
| Q |
201 |
tgttccagtgaatcattctcaaaacctttgttgatattcttc |
242 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
45763420 |
tgttccagtgaatcattctcaaaacctctgttgattttcttc |
45763461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University