View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7400_low_36 (Length: 215)
Name: NF7400_low_36
Description: NF7400
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7400_low_36 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 128; Significance: 2e-66; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 128; E-Value: 2e-66
Query Start/End: Original strand, 18 - 198
Target Start/End: Complemental strand, 38788634 - 38788452
Alignment:
| Q |
18 |
agaatggacaaaatcagagagaataccaaacaaaaacagatcacaaaattgacaggtaacacctcaacaggacacaaggnnnnnnnnnc-ggaaaattca |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
38788634 |
agaatggacaaaatcagagagaataccaaacaaaaacagatcacgaaattgacaggtaacacctcaacaggacacaagaaaaaaaaaaatggaaaattca |
38788535 |
T |
 |
| Q |
117 |
cccgctgcccctgatttatgcaacatcactactcatttgacaccaaaaaatagccacaccacccatt-ttttgcaatagcaac |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
38788534 |
cccgctgcccctgatttatgcaacatcactactcatttgacaccaaaaaatagccacaccacccatttttttgcaatagcaac |
38788452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University