View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7401_low_16 (Length: 310)
Name: NF7401_low_16
Description: NF7401
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7401_low_16 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 17 - 300
Target Start/End: Original strand, 1040124 - 1040412
Alignment:
| Q |
17 |
catttatcgcttcctttgtcgcaaagttgtttatgctgttgtccgaatcttttggacaatgaataagaaacattgtttgtgacaaaggcagatggttgta |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
1040124 |
catttatcgcttcctttgtcgcaaagttgtttatgctgttgtccgaatcttttggacaatgaataagaattgttgtttgtgacaaaggcagatggttgta |
1040223 |
T |
|
| Q |
117 |
atggagaggtattggattaaccttgacgtgtttatattagtaaaggtgttgtattgtggttagcaaaccactcgttagaactttagaccacccgcaacat |
216 |
Q |
| |
|
|||||||||||| |||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
1040224 |
atggagaggtatcggattaaccttgacatgttaatattagtaaaggtgttgtattgtggttagcaaaccactcgttagaactttagaccacccgcagcat |
1040323 |
T |
|
| Q |
217 |
agtaccctaaactgggtgattaaataggtcccttatgtctacgtcacttattttat-----ggtaatacttaataatcgtccatattct |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||| ||||| |||| |
|
|
| T |
1040324 |
agtaccctaaactgggtgattaaataggtctcttatgtctacgtcacttattttactttacggtaatacttaataatcatccattttct |
1040412 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University