View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7401_low_21 (Length: 247)
Name: NF7401_low_21
Description: NF7401
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7401_low_21 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 1 - 240
Target Start/End: Complemental strand, 10566756 - 10566517
Alignment:
| Q |
1 |
taactttctattgaatcaaagctatgccagtacgtcttttggtgagctactgcattctggtttggaagattcagaggtggaacagtataaatatttagaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10566756 |
taactttctattgaatcaaagctatgccagtacgtcttttggtgagctactgcattctggtttggaagattcagaggtggaacagtataaatatttagaa |
10566657 |
T |
|
| Q |
101 |
acaaataatgatgcatgcttaaacaacacacataaatcacttgatatgtcctggtttccagaatcaagatttgtttccgagactgcaattcaaaacagaa |
200 |
Q |
| |
|
|||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10566656 |
acaaataatgatacatgcttaaacaacacatataaatcacttgatatgtcctggtttccagaatcaagatttgtttccgagactgcaattcaaaacagaa |
10566557 |
T |
|
| Q |
201 |
cagaaacattgtctacagttgtgtcttctgatgtccatct |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||| || |||||| |
|
|
| T |
10566556 |
cagaaacattgtctacagttgtgtcttctggtggccatct |
10566517 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University