View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7401_low_22 (Length: 245)
Name: NF7401_low_22
Description: NF7401
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7401_low_22 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 108; Significance: 2e-54; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 21 - 160
Target Start/End: Original strand, 19286029 - 19286168
Alignment:
| Q |
21 |
aaaagaataaagattaaaattacttttaaacaatttgtaatgaaccaatgtgccaattgtgggatggaattggtttggacatatttttaggcccacttat |
120 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||| || ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
19286029 |
aaaagaataaagattaaaattactttaaaacattttgtaatgaaccaatgtgccaattgttggctggaactggtttggacatatttttaggcccacttat |
19286128 |
T |
|
| Q |
121 |
gttagaaagaaccctagaacaaaaactaaacatctcttta |
160 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
19286129 |
gttagaaagtttcctagaacaaaaactaaacatctcttta |
19286168 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 172 - 234
Target Start/End: Original strand, 19286726 - 19286791
Alignment:
| Q |
172 |
tacaatgttgcagcc----ccttgcttctctatttttattttctagtcctgcttctctcctctctct |
234 |
Q |
| |
|
||||||||||||||| |||||||||||| |||| ||||||||||||||||||||||||||||| |
|
|
| T |
19286726 |
tacaatgttgcagccgctcccttgcttctctcttttc-ttttctagtcctgcttctctcctctctct |
19286791 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University