View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7402_high_10 (Length: 334)
Name: NF7402_high_10
Description: NF7402
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7402_high_10 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 277; Significance: 1e-155; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 15 - 320
Target Start/End: Original strand, 32692570 - 32692875
Alignment:
| Q |
15 |
acatcaaagcatactcnnnnnnncaacctccaatcagctttagctcatcagggtgacatcttccaagtaactcaaaactagtagtaaaaaatttacaatt |
114 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
32692570 |
acatcaaagcatactctttttttcaacctccaatcagctttagctcatcagggtgacatcttccaagtaactcaaaattagtagtaaaaaatttacaatt |
32692669 |
T |
|
| Q |
115 |
gcaaacaacagctaacattgatttctgtcatacaaaagtttcacaaaattttccatccatcctgttctgaacagccttcacagcagcaactctagcagca |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32692670 |
gcaaacaacagctaacattgatttctgtcatacaaaagtttcacaaaattttccatccatcctgttctgaacagccttcacagcagcaactctagcagca |
32692769 |
T |
|
| Q |
215 |
gtggcggctttgtttgcagcgatcgctgcattgttaacctggtcttcgacccgcttaaggtttatcgcattctcagctgttttcctagcagcctgcagtt |
314 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32692770 |
gtggcggctttgtttgcagcgatcactgcattgttaacctggtcttcgacccgcttaaggtttatcgcattctcagctgttttcctagcagcctgcagtt |
32692869 |
T |
|
| Q |
315 |
taaaat |
320 |
Q |
| |
|
|||||| |
|
|
| T |
32692870 |
taaaat |
32692875 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 42; Significance: 0.000000000000008; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 158 - 231
Target Start/End: Original strand, 24236987 - 24237060
Alignment:
| Q |
158 |
caaaattttccatccatcctgttctgaacagccttcacagcagcaactctagcagcagtggcggctttgtttgc |
231 |
Q |
| |
|
|||||||||||| |||| || | ||||||||| |||||||| ||||||||||||||||||||||| ||||||| |
|
|
| T |
24236987 |
caaaattttccacccattctatcctgaacagctttcacagctgcaactctagcagcagtggcggccctgtttgc |
24237060 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University