View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7402_low_12 (Length: 270)
Name: NF7402_low_12
Description: NF7402
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7402_low_12 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 147; Significance: 1e-77; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 87 - 245
Target Start/End: Original strand, 42035011 - 42035169
Alignment:
| Q |
87 |
tgagagaggaagtgctagcggttactggatggtgataagcttgtaaatgcatggttttactgtgtaattagtattgatttcacagatactttgtattgag |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
42035011 |
tgagagaggaagtgctagcggttactggatggtgataaacttgtaattgcatggttttactgtgtaattagtattgatttcacagatactttgtactgag |
42035110 |
T |
|
| Q |
187 |
taccaatctcttttgctagggtggtgattatctaaaataaatagtttttagaaggatgg |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42035111 |
taccaatctcttttgctagggtggtgattatctaaaataaatagtttttagaaggatgg |
42035169 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 1 - 56
Target Start/End: Original strand, 42034961 - 42035012
Alignment:
| Q |
1 |
ctatatgatttcatgctcataattaagagcctgatagacttcctgatttacaactg |
56 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
42034961 |
ctatatgatttcatgctcataa----gagcctgatagacttcctgatttacaactg |
42035012 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University