View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7402_low_14 (Length: 239)
Name: NF7402_low_14
Description: NF7402
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7402_low_14 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 48; Significance: 1e-18; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 130 - 221
Target Start/End: Original strand, 6800561 - 6800652
Alignment:
| Q |
130 |
tgtgttaggagttgcctgtttcttttattaccttcaagctatgaaacctcaatacagacatcttacacgacactaacactgacacaaagaca |
221 |
Q |
| |
|
|||||||||| || |||||||||||||||||||| |||||||||||| || ||| |||||||||||||||||||| |||||||||||| |
|
|
| T |
6800561 |
tgtgttaggaattccctgtttcttttattacctttaagctatgaaacacgaacacatgcatcttacacgacactaacatggacacaaagaca |
6800652 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 134 - 176
Target Start/End: Original strand, 6483017 - 6483059
Alignment:
| Q |
134 |
ttaggagttgcctgtttcttttattaccttcaagctatgaaac |
176 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
6483017 |
ttaggagtttcctgtttcttttattaccttcaagctatgaaac |
6483059 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 130 - 175
Target Start/End: Complemental strand, 8451489 - 8451444
Alignment:
| Q |
130 |
tgtgttaggagttgcctgtttcttttattaccttcaagctatgaaa |
175 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
8451489 |
tgtgttaggagttgtttgtttcttttattacctttaagctatgaaa |
8451444 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 8 - 41
Target Start/End: Original strand, 6800436 - 6800469
Alignment:
| Q |
8 |
ttgttctgttttatgctttaacgtttgaatgttt |
41 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |
|
|
| T |
6800436 |
ttgttctgttttatgcttaaacgtttgaatgttt |
6800469 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University