View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7402_low_17 (Length: 203)
Name: NF7402_low_17
Description: NF7402
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7402_low_17 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 132; Significance: 9e-69; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 132; E-Value: 9e-69
Query Start/End: Original strand, 23 - 189
Target Start/End: Original strand, 42159254 - 42159433
Alignment:
| Q |
23 |
gtcacctcatcccctgccaataccgatgccattttacaaactagtttctcaaacagataacatatatatcttcttactatatatagtagattag------ |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42159254 |
gtcacctcatcccctgccaataccgatgccattttacaaactagtttctcaaacagataacatatatatcttcttactatatatagtagattagtatgta |
42159353 |
T |
|
| Q |
117 |
-------ttttttctttctgaaatgatttttaaagtgcttcgtctatagcgactaaagtttcctataagtagaataatgt |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
42159354 |
tataattttttttctttctgaaatgatttttaaagtgcttcgtctatagcgactaaagtttcctataagtagaagaatgt |
42159433 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 23 - 79
Target Start/End: Original strand, 42180228 - 42180284
Alignment:
| Q |
23 |
gtcacctcatcccctgccaataccgatgccattttacaaactagtttctcaaacaga |
79 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||| |
|
|
| T |
42180228 |
gtcacctcatcccctgccaatacggatgccattttactaactagtttctcaaacaga |
42180284 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 23 - 74
Target Start/End: Original strand, 42146941 - 42146992
Alignment:
| Q |
23 |
gtcacctcatcccctgccaataccgatgccattttacaaactagtttctcaa |
74 |
Q |
| |
|
||||||||||||| ||||| ||||||||||||||||| ||||| |||||||| |
|
|
| T |
42146941 |
gtcacctcatcccttgccattaccgatgccattttactaactaatttctcaa |
42146992 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University