View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7403_low_4 (Length: 301)
Name: NF7403_low_4
Description: NF7403
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7403_low_4 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 262; Significance: 1e-146; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 7 - 288
Target Start/End: Original strand, 33807838 - 33808119
Alignment:
| Q |
7 |
agatggacatcacaaatgcaatgtctaaaatataggacacggggacaagatgcacacacacaaagatacaaaagggttataaagcatatcattcaaggtt |
106 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33807838 |
agatggacacaacaaatgcaatgtctaaaatataggacacggggacaagatgcacacacacaaagatacaaaagggttataaagcatatcattcaaggtt |
33807937 |
T |
|
| Q |
107 |
taacaaaacagctttgaaatagtgtgatgcttacccaagctacccttatcatgaatttgaggacttgtagctaacagcctcttgccttggttgatttttc |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
33807938 |
taacaaaacagctttgaaatagtgtgatgcttacccaagctacccttatcatgaatttgaggacttgtagctaacagcctcttgccttgattgatttttc |
33808037 |
T |
|
| Q |
207 |
tgcaaaacacgtcaaaacggaaatcaaccaaattgttactttaagagacacgtatatttatgcactcaatgcccactgatgt |
288 |
Q |
| |
|
|||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33808038 |
tgcaaaacacgtcaaaacagatatcaaccaaattgttactttaagagacacgtatatttatgcactcaatgcccactgatgt |
33808119 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University