View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7404_low_6 (Length: 238)
Name: NF7404_low_6
Description: NF7404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7404_low_6 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 237
Target Start/End: Complemental strand, 25249909 - 25249671
Alignment:
| Q |
1 |
gcctataatatacttttaaaatatcaataaatattagcttaaataatcaa--gtagtcgagttattttctttgccggttaattatttttgtccgatataa |
98 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
25249909 |
gcctagaatatacttttaaaatatcaataaatattagcttaaataatcaattgtagtagagttattttcattgccggttaattatttttgtccgatataa |
25249810 |
T |
 |
| Q |
99 |
actttttgtctacgtagaaataaaactactacaaagattctatgggaatactagctaatatatttttaatctattccctcaacatgccaatttatttcta |
198 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25249809 |
actttttgtttacgtagaaagaaaactactacaaagattctatgggaatactagctaatatatttttaatctattccctcaacatgccaatttatttcta |
25249710 |
T |
 |
| Q |
199 |
acgtaccacaacatatttgtcatgatccaaaaaagagta |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25249709 |
acgtaccacaacatatttgtcatgatccaaaaaagagta |
25249671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University