View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7405_high_16 (Length: 267)
Name: NF7405_high_16
Description: NF7405
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7405_high_16 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 96; Significance: 4e-47; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 96; E-Value: 4e-47
Query Start/End: Original strand, 8 - 111
Target Start/End: Original strand, 34225355 - 34225458
Alignment:
| Q |
8 |
aattatacttggtattactgcagacatatcctaatcctttgcaagacaaccctgcttactcagttgtaaagtgagtttgtttttctctctcttatttgtg |
107 |
Q |
| |
|
|||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34225355 |
aattgtacttggtgttactgcagacatatcctaatcctttgcaagacaaccctgcttactcagttgtaaagtgagtttgtttttctctctcttatttgtg |
34225454 |
T |
 |
| Q |
108 |
tgat |
111 |
Q |
| |
|
|||| |
|
|
| T |
34225455 |
tgat |
34225458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 180 - 244
Target Start/End: Original strand, 34225527 - 34225591
Alignment:
| Q |
180 |
attttcaggcagtattttgtgcatgttgatgacacagttcctcagaaggttggtattttttgttt |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34225527 |
attttcaggcagtattttgtgcatgttgatgacacagttcctcagaaggttggtattttttgttt |
34225591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 27 - 85
Target Start/End: Complemental strand, 42980718 - 42980660
Alignment:
| Q |
27 |
gcagacatatcctaatcctttgcaagacaaccctgcttactcagttgtaaagtgagttt |
85 |
Q |
| |
|
|||||||||| ||||||| ||||||||||| |||||||| |||||||| |||| ||||| |
|
|
| T |
42980718 |
gcagacatattctaatccattgcaagacaatcctgcttattcagttgtcaagtaagttt |
42980660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 182 - 230
Target Start/End: Original strand, 51581880 - 51581928
Alignment:
| Q |
182 |
tttcaggcagtattttgtgcatgttgatgacacagttcctcagaaggtt |
230 |
Q |
| |
|
||||||||||||||| |||||| | |||||||| ||||||||||||||| |
|
|
| T |
51581880 |
tttcaggcagtatttcgtgcatatggatgacaccgttcctcagaaggtt |
51581928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University