View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7405_high_9 (Length: 371)
Name: NF7405_high_9
Description: NF7405
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7405_high_9 |
 |  |
|
| [»] scaffold0016 (3 HSPs) |
 |  |  |
|
| [»] scaffold0642 (3 HSPs) |
 |  |  |
|
| [»] scaffold0345 (3 HSPs) |
 |  |  |
|
| [»] scaffold0105 (3 HSPs) |
 |  |  |
|
| [»] scaffold1526 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0016 (Bit Score: 246; Significance: 1e-136; HSPs: 3)
Name: scaffold0016
Description:
Target: scaffold0016; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 4 - 280
Target Start/End: Complemental strand, 54087 - 53813
Alignment:
| Q |
4 |
actttggtgttcattgcatagaataaatgttatttagtacaaaatgtctgagatgaaattgaatattactaagtcttagtaaatgagtactgaccaaatt |
103 |
Q |
| |
|
||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
54087 |
actttgggcttcattgcttagaataaatgttatttagtacaaaatgtctgagatgaaattgaatatta--aagtcttagtaaatgagtactgacaaaatt |
53990 |
T |
 |
| Q |
104 |
accaaagaggatcaaaacatttaagataggaataatttgtggctgatgatgttgctcctaatagtgatacaatacttactttctctctaacatcattcca |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53989 |
accaaagaggatcaaaacatttaagataggaataatttgtggctgatgatgttgctcctaatagtgatacaatacttactttctctctaacatcattcca |
53890 |
T |
 |
| Q |
204 |
atccggtccttcttctctcacactctattcatacccatccatgaattcactctagagcggtgagtggcttcgttctt |
280 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
53889 |
atccggtccttcttctctcacactctattcatacccatccatgaattcactccagagcggtgagtggcttcgttctt |
53813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016; HSP #2
Raw Score: 79; E-Value: 7e-37
Query Start/End: Original strand, 276 - 354
Target Start/End: Complemental strand, 51290 - 51212
Alignment:
| Q |
276 |
ttcttttatgcccatcacatagaggatatagtataataccaccctacgaccaaaaggaaactcataaaaggatgatctt |
354 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51290 |
ttcttttatgcccatcacatagaggatatagtataataccaccctacgaccaaaaggaaactcataaaaggatgatctt |
51212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 17 - 66
Target Start/End: Complemental strand, 37656 - 37607
Alignment:
| Q |
17 |
ttgcatagaataaatgttatttagtacaaaatgtctgagatgaaattgaa |
66 |
Q |
| |
|
||||||||||||| |||||||||| ||||||| ||| |||||||||||| |
|
|
| T |
37656 |
ttgcatagaataattgttatttagaacaaaatttctacgatgaaattgaa |
37607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0642 (Bit Score: 79; Significance: 7e-37; HSPs: 3)
Name: scaffold0642
Description:
Target: scaffold0642; HSP #1
Raw Score: 79; E-Value: 7e-37
Query Start/End: Original strand, 276 - 354
Target Start/End: Original strand, 6663 - 6741
Alignment:
| Q |
276 |
ttcttttatgcccatcacatagaggatatagtataataccaccctacgaccaaaaggaaactcataaaaggatgatctt |
354 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6663 |
ttcttttatgcccatcacatagaggatatagtataataccaccctacgaccaaaaggaaactcataaaaggatgatctt |
6741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0642; HSP #2
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 178 - 241
Target Start/End: Original strand, 4102 - 4165
Alignment:
| Q |
178 |
cttactttctctctaacatcattccaatccggtccttcttctctcacactctattcatacccat |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
4102 |
cttactttctctctaacatcattccaatccggttcttcttctctcacactctattcatacccat |
4165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0642; HSP #3
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 236 - 280
Target Start/End: Original strand, 4184 - 4228
Alignment:
| Q |
236 |
acccatccatgaattcactctagagcggtgagtggcttcgttctt |
280 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
4184 |
acccatccatgaattcactccagatcggtgagtggcttcgttctt |
4228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0345 (Bit Score: 79; Significance: 7e-37; HSPs: 3)
Name: scaffold0345
Description:
Target: scaffold0345; HSP #1
Raw Score: 79; E-Value: 7e-37
Query Start/End: Original strand, 276 - 354
Target Start/End: Original strand, 16576 - 16654
Alignment:
| Q |
276 |
ttcttttatgcccatcacatagaggatatagtataataccaccctacgaccaaaaggaaactcataaaaggatgatctt |
354 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16576 |
ttcttttatgcccatcacatagaggatatagtataataccaccctacgaccaaaaggaaactcataaaaggatgatctt |
16654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0345; HSP #2
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 178 - 241
Target Start/End: Original strand, 14014 - 14077
Alignment:
| Q |
178 |
cttactttctctctaacatcattccaatccggtccttcttctctcacactctattcatacccat |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
14014 |
cttactttctctctaacatcattccaatccggttcttcttctctcacactctattcatacccat |
14077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0345; HSP #3
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 236 - 280
Target Start/End: Original strand, 14096 - 14140
Alignment:
| Q |
236 |
acccatccatgaattcactctagagcggtgagtggcttcgttctt |
280 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
14096 |
acccatccatgaattcactccagatcggtgagtggcttcgttctt |
14140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0105 (Bit Score: 79; Significance: 7e-37; HSPs: 3)
Name: scaffold0105
Description:
Target: scaffold0105; HSP #1
Raw Score: 79; E-Value: 7e-37
Query Start/End: Original strand, 276 - 354
Target Start/End: Complemental strand, 22406 - 22328
Alignment:
| Q |
276 |
ttcttttatgcccatcacatagaggatatagtataataccaccctacgaccaaaaggaaactcataaaaggatgatctt |
354 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22406 |
ttcttttatgcccatcacatagaggatatagtataataccaccctacgaccaaaaggaaactcataaaaggatgatctt |
22328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0105; HSP #2
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 178 - 241
Target Start/End: Complemental strand, 24967 - 24904
Alignment:
| Q |
178 |
cttactttctctctaacatcattccaatccggtccttcttctctcacactctattcatacccat |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
24967 |
cttactttctctctaacatcattccaatccggttcttcttctctcacactctattcatacccat |
24904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0105; HSP #3
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 236 - 280
Target Start/End: Complemental strand, 24885 - 24841
Alignment:
| Q |
236 |
acccatccatgaattcactctagagcggtgagtggcttcgttctt |
280 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
24885 |
acccatccatgaattcactccagatcggtgagtggcttcgttctt |
24841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 79; Significance: 7e-37; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 79; E-Value: 7e-37
Query Start/End: Original strand, 276 - 354
Target Start/End: Original strand, 15708819 - 15708897
Alignment:
| Q |
276 |
ttcttttatgcccatcacatagaggatatagtataataccaccctacgaccaaaaggaaactcataaaaggatgatctt |
354 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15708819 |
ttcttttatgcccatcacatagaggatatagtataataccaccctacgaccaaaaggaaactcataaaaggatgatctt |
15708897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 178 - 241
Target Start/End: Original strand, 15707358 - 15707421
Alignment:
| Q |
178 |
cttactttctctctaacatcattccaatccggtccttcttctctcacactctattcatacccat |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15707358 |
cttactttctctctaacatcattccaatccggtccttcttctctcacactctattcatacccat |
15707421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 276 - 354
Target Start/End: Complemental strand, 26795981 - 26795899
Alignment:
| Q |
276 |
ttcttttatgcccatcacatagaggatatagtataataccaccctacgaccaaaagg----aaactcataaaaggatgatctt |
354 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |||||| |||| ||||||||| ||||| |||||| ||||||||| |
|
|
| T |
26795981 |
ttcttttatgcccatcacatagagtatatagtatggtaccactctacaaccaaaaggttgtaaactaataaaaagatgatctt |
26795899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 236 - 280
Target Start/End: Original strand, 15707440 - 15707484
Alignment:
| Q |
236 |
acccatccatgaattcactctagagcggtgagtggcttcgttctt |
280 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
15707440 |
acccatccatgaattcactccagatcggtgagtggcttcgttctt |
15707484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 79; Significance: 7e-37; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 79; E-Value: 7e-37
Query Start/End: Original strand, 276 - 354
Target Start/End: Original strand, 3380883 - 3380961
Alignment:
| Q |
276 |
ttcttttatgcccatcacatagaggatatagtataataccaccctacgaccaaaaggaaactcataaaaggatgatctt |
354 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3380883 |
ttcttttatgcccatcacatagaggatatagtataataccaccctacgaccaaaaggaaactcataaaaggatgatctt |
3380961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 178 - 233
Target Start/End: Original strand, 3378229 - 3378284
Alignment:
| Q |
178 |
cttactttctctctaacatcattccaatccggtccttcttctctcacactctattc |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3378229 |
cttactttctctctaacatcattccaatccggtccttcttctctcacactctattc |
3378284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 236 - 280
Target Start/End: Original strand, 3378316 - 3378360
Alignment:
| Q |
236 |
acccatccatgaattcactctagagcggtgagtggcttcgttctt |
280 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
3378316 |
acccatccatgaattcactccagatcggtgagtggcttcgttctt |
3378360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1526 (Bit Score: 56; Significance: 4e-23; HSPs: 2)
Name: scaffold1526
Description:
Target: scaffold1526; HSP #1
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 178 - 233
Target Start/End: Complemental strand, 1304 - 1249
Alignment:
| Q |
178 |
cttactttctctctaacatcattccaatccggtccttcttctctcacactctattc |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1304 |
cttactttctctctaacatcattccaatccggtccttcttctctcacactctattc |
1249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1526; HSP #2
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 236 - 280
Target Start/End: Complemental strand, 1217 - 1173
Alignment:
| Q |
236 |
acccatccatgaattcactctagagcggtgagtggcttcgttctt |
280 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
1217 |
acccatccatgaattcactccagatcggtgagtggcttcgttctt |
1173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 56; Significance: 4e-23; HSPs: 4)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 178 - 241
Target Start/End: Original strand, 44495504 - 44495567
Alignment:
| Q |
178 |
cttactttctctctaacatcattccaatccggtccttcttctctcacactctattcatacccat |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
44495504 |
cttactttctctctaacatcattccaatccggttcttcttctctcacactccattcatacccat |
44495567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 312 - 354
Target Start/End: Original strand, 44498316 - 44498358
Alignment:
| Q |
312 |
taccaccctacgaccaaaaggaaactcataaaaggatgatctt |
354 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44498316 |
taccaccctacgaccaaaaggaaactcataaaaggatgatctt |
44498358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 276 - 314
Target Start/End: Original strand, 44498151 - 44498189
Alignment:
| Q |
276 |
ttcttttatgcccatcacatagaggatatagtataatac |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44498151 |
ttcttttatgcccatcacatagaggatatagtataatac |
44498189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 239 - 280
Target Start/End: Original strand, 44495589 - 44495630
Alignment:
| Q |
239 |
catccatgaattcactctagagcggtgagtggcttcgttctt |
280 |
Q |
| |
|
||||||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
44495589 |
catccatgaattcactccagatcggtgagtggcttcgttctt |
44495630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 48; Significance: 2e-18; HSPs: 5)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 17 - 86
Target Start/End: Original strand, 21140128 - 21140194
Alignment:
| Q |
17 |
ttgcatagaataaatgttatttagtacaaaatgtctgagatgaaattgaatattactaagtcttagtaaa |
86 |
Q |
| |
|
||||||||||||| |||||||||| |||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
21140128 |
ttgcatagaataattgttatttagaacaaaatgtctgagatgaaattgaatat---taagtcttagtaaa |
21140194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 93 - 177
Target Start/End: Original strand, 21221835 - 21221922
Alignment:
| Q |
93 |
ctgaccaaattaccaaagaggatcaa---aacatttaagataggaataatttgtggctgatgatgttgctcctaatagtgatacaata |
177 |
Q |
| |
|
|||| ||||||||||||||||||||| |||| | || |||||||| || |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
21221835 |
ctgaacaaattaccaaagaggatcaagaaaacactgaaaataggaattatctgtggctgatgatgttgctcctaatagtgatataata |
21221922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 17 - 68
Target Start/End: Original strand, 21221708 - 21221759
Alignment:
| Q |
17 |
ttgcatagaataaatgttatttagtacaaaatgtctgagatgaaattgaata |
68 |
Q |
| |
|
||||||||||||| |||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
21221708 |
ttgcatagaataattgttatttagaacaaaatgtctgagatgaaattgaata |
21221759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 18 - 66
Target Start/End: Complemental strand, 21246005 - 21245957
Alignment:
| Q |
18 |
tgcatagaataaatgttatttagtacaaaatgtctgagatgaaattgaa |
66 |
Q |
| |
|
|||||||||||| ||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
21246005 |
tgcatagaataattgttatttataacaaaatgtatgagatgaaattgaa |
21245957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 17 - 66
Target Start/End: Original strand, 21200690 - 21200739
Alignment:
| Q |
17 |
ttgcatagaataaatgttatttagtacaaaatgtctgagatgaaattgaa |
66 |
Q |
| |
|
||||||| | ||| |||||||||| ||||||||||| ||||||||||||| |
|
|
| T |
21200690 |
ttgcataaagtaattgttatttagaacaaaatgtctaagatgaaattgaa |
21200739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University